Proteins of protoplasts from red alga Porphyra yezoensis.
نویسندگان
چکیده
منابع مشابه
Isolation and regeneration of transiently transformed protoplasts from gametophytic blades of the marine red alga Porphyra yezoensis
Despite the recent progress of transient gene expression systems in a red alga Porphyra yezoensis by particle bombardment, a stable transformation system has yet to establish in any marine red macrophytes. One of the reasons of the difficulty in genetic transformation in red algae is the lack of systems to select and isolate transformed cells from gametophytic blades. Thus, toward the establish...
متن کاملIsolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملCharacterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3...
متن کاملEffects of cell wall synthesis on cell polarity in the red alga Porphyra yezoensis.
Polarity is a fundamental cell property essential for differentiation, proliferation and morphogenesis in unicellular and multicellular organisms. We have recently demonstrated that phosphatidylinositol 3-kinase (PI3K) activity is required for the establishment of anterior-posterior axis, leading to asymmetrical localization of F-actin in migrating monospores of the red alga Porphyra yezoensis....
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: NIPPON SUISAN GAKKAISHI
سال: 1990
ISSN: 1349-998X,0021-5392
DOI: 10.2331/suisan.56.1859